• Users Online: 665
  • Print this page
  • Email this page

ORIGINAL ARTICLE Table of Contents  
Ahead of print publication
Long non-coding RNA LINC00565 regulates ADAM19 expression through sponging MicroRNA-532-3p, thereby facilitating clear cell renal cell carcinoma progression


 Department of Urology, Tangshan Gongren Hospital, Tangshan, China

Click here for correspondence address and email

Date of Submission09-May-2023
Date of Decision07-Jul-2023
Date of Acceptance04-Aug-2023
Date of Web Publication03-Nov-2023
 

  Abstract 


Proven by publications, long non-coding RNAs (lncRNAs) play critical roles in the development of clear cell renal cell carcinoma (ccRCC). Although lncRNA LINC00565 has been implicated in the progression of various cancers, its biological effects on ccRCC remain unknown. This study aimed to investigate the biological functions of LINC00565, as well as its potential mechanism in ccRCC. Here, the expression data of mature microRNAs (miRNAs) (normal: 71, tumor: 545), messenger RNAs (mRNAs), and lncRNAs (normal: 72, tumor: 539) of ccRCC were acquired from The Cancer Genome Atlas (TCGA) database and subjected to differential expression analysis. Quantitative reverse transcriptase polymerase chain reaction analyzed the expression levels of LINC00565, miR-532-3p, and ADAM19 mRNA. TCGA database, dual-luciferase report detection, and Argonaute 2 RNA immunoprecipitation were utilized to confirm the relationships between LINC00565 and miR-532-3p and between miR-532-3p and ADAM19, respectively. The progression of ccRCC cells was determined via CCK-8, colony formation, scratch healing, and transwell assays. Western blot was applied to detect the protein levels of epithelial-mesenchymal transition markers and ADAM19. We herein suggested that LINC00565 was prominently upregulated in ccRCC tissues and cells. Knockdown of LINC00565 repressed cell progression. We further predicted and validated miR-532-3p as a target of LINC00565, and miR-532-3p could target ADAM19. Knockdown of LINC00565 resulted in ADAM19 level downregulation in ccRCC cells and suppressed miR-532-3p could restore ADAM19 level. Thus, the three RNAs constructed a ceRNA network. Overexpressed ADAM19 could eliminate the anticancer effects caused by knocking down LINC00565 on ccRCC cells. In conclusion, LINC00565 upregulated ADAM19 via absorbing miR-532-3p, thereby facilitating the progression of ccRCC cells.

Keywords: ADAM19, clear cell renal cell carcinoma, LINC00565, miR-532-3p


How to cite this URL:
Meng B, Wang P, Zhao C, Yin G, Meng X, Li L, Cai S, Yan C. Long non-coding RNA LINC00565 regulates ADAM19 expression through sponging MicroRNA-532-3p, thereby facilitating clear cell renal cell carcinoma progression. Chin J Physiol [Epub ahead of print] [cited 2023 Nov 30]. Available from: https://www.cjphysiology.org/preprintarticle.asp?id=389334





  Introduction Top


Renal cell carcinoma (RCC) is a common malignancy that accounts for 3.7% of all cancer cases.[1] There are three main histological subtypes of RCC: clear cell RCC (ccRCC), chromophobe RCC, and papillary RCC. Among them, the number of ccRCC cases composite approximately 70%– 80% of all RCC cases.[2] ccRCC is more likely to metastasize than the other subtypes. About 30% of patients have metastases since they were diagnosed with ccRCC.[3] Although there are targeted drugs in first-line treatment and immune checkpoint monoclonal antibodies in second- and third-line treatment, defects such as drug toxicity hinder some patients from benefiting from drugs.[4],[5] The development of new drugs and treatments is still in demand. This paper aimed to deeply study the modulatory mechanism of ccRCC malignant progression and shed light on the theoretical basis of developing new diagnostic markers and drugs, as well as the rational use of current drugs.

Recently, an increasing number of studies focus on long non-coding RNAs (lncRNAs). LncRNAs do not encode proteins. Some reports have shown that lncRNAs can predict the prognosis of cancer patients.[6],[7] For instance, LINC00565 is upregulated in endometrial cancer and is closely linked to poor prognosis.[8] In ovarian cancer (OC), a high LINC00565 level favors OC cell progression.[9] Upregulated LINC00565 could promote the malignant development of colorectal cancer via upregulating enhancer of zeste homolog 2.[10] Nevertheless, the mechanism of LINC00565 in ccRCC is not elucidated.

LncRNAs function in multiple mechanisms, among which competing endogenous RNA (ceRNA) regulation is an important method for cancer regulation.[11],[12] ceRNAs are a type of RNA that regulate their post-transcriptional expression by competing for shared microRNAs (miRNAs). Noncoding RNA regulates messenger RNAs (mRNAs) of coding proteins by binding to miRNAs. This kind of regulation is based on the fact that miRNAs can target mRNAs to regulate protein levels.[13] Han et al.[14] identified via bioinformatics approach that has miR-532-3p as a potential biomarker for survival and prognosis of ccRCC patients. Gao et al.[15] revealed that miR-532-3p repressed ccRCC cell progression by downregulating TROAP. Further, previous studies revealed that LINC00052 attenuated acute kidney injury via sponging miR-532-3p as well as activating Wnt signaling.[16] As reported, LINC00565 targets the miR-665/AKT axis via ceRNA regulatory mechanisms to impel the proliferation of gastric cancer (GC) cells.[17] Nevertheless, LINC00565 is not reported yet whether it affects the malignant progression of ccRCC via miR-532-3p.

ADAM Metallopeptidase Domain 19 (ADAM19) belongs to a disintegrin and metalloproteinases (ADAMs) family and participates in biological functions such as cell progression and adhesion as reported.[18],[19] Recent studies suggested that ADAM19 was overexpressed in copious cancers and facilitated the migration and invasion of cancer cells.[18],[20],[21] Yet, no study reveals how LINC00565, miR-532-3p, and ADAM19 interplay in ccRCC.

Given what was discovered before, we posited that LINC00565 facilitated the malignant progression of ccRCC via miR-532-3p/ADAM19 axis. We tried to dissect the way LINC00565 impacted ccRCC cell progression, as well as the molecular mechanisms involved downstream. Ultimately, it was suggested that LINC00565 exhibited cancer-promoting biological functions and regulated the downstream miR-532-3p/ADAM19 regulatory axis, which in turn affected ccRCC progression.


  Materials and Methods Top


Differentially expressed gene analysis and target prediction by bioinformatics methods

Bioinformatic predictions for ccRCC were as previously described.[22] The expression data of mature miRNAs (normal: 71, tumor: 545), mRNAs, and lncRNAs (normal: 72, tumor: 539) of ccRCC were acquired from The Cancer Genome Atlas (TCGA, https://portal.gdc.cancer.gov/). They were subjected to differential expression analysis adopting R package “edgeR” (|logFC| > 1.5, padj < 0.05).[23] The subcellular localization of target lncRNA was tested by lncATLAS (http://lncatlas.crg.eu/), whose downstream miRNAs were predicted via lncBase (http://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=lncbasev2/index-predicted). These miRNAs were overlapped with differentially expressed miRNAs (DEmiRNAs) to obtain the target miRNA. The target mRNAs of target miRNA were predicted via starBase (http://starbase.sysu.edu.cn/), TargetScan (http://www.targetscan.org/vert_72/), miRWalk (http://mirwalk.umm.uni-heidelberg.de/). These mRNAs were intersected with DEmRNAs to determine the target mRNA. The enriched pathways of the target mRNA were analyzed via Gene Set Enrichment Analysis (GSEA).

Cell culture and transfection

Normal human kidney proximal tubular epithelial cells HK-2 (BNCC338012) and human ccRCC cells OS-RC-2 (BNCC100109), Caki-1 (BNCC100191), 786-O (BNCC338473), and A498 (BNCC338630) were all supplied by BeNa Culture Collection (China) and cultivated in an incubator with 5% CO2 at 37°C. HK-2 and 786-O were cultured in Dulbecco's Modified Eagle Medium-high glucose (with 10% fetal bovine serum (FBS), BNCC338068). OS-RC-2 and A498 were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640, with 10% FBS, BNCC338360). Caki-1 was cultured in McCoy's 5a medium (with 10% FBS, BNCC338364). 100 U/mL penicillin and 100 μg/mL streptomycin (Sigma-Aldrich, USA) were introduced to all cell cultures.

MiR-532-3p mimic, miR-532-3p inhibitor, si-LINC00565-1, si-LINC00565-2, and corresponding negative controls (scrambles) were acquired from RiboBio (China). Overexpressed ADAM19 was constructed by using pcDNA3.1 vector (Invitrogen, USA). Cells were transfected as previously.[10] After the cell were harvested, 50 nM si-LINC00565-1, 50 nM si-LINC00565-2, 100 nM miR-532-3p mimic, 75 nM miR-532-3p inhibitor were plated into six-well plates. Cell transfection was performed by Lipofectamine 2000 reagent (Invitrogen, USA). After 5 h, the medium was replaced with a complete medium, and subsequent experimental procedures were performed 24 h later. The sequences were miR-532-3p mimic, 5'-CCUCCCACACCCAAGGCUUGCA-3'; miR-532-3p inhibitor, 5'-UGCAAGCCUUGGGUGUGGGAGG-3'; si-LINC00565-1, 5'-GAUUCACGACGUUGUGCAACC-3'; si-LINC00565-2, 5'-GGAUCUUGACAAAGUUGGACA-3'; scramble for mimic: 5'-UCCCAAGACCCGACCUUCCGCA-3'; scramble for inhibitor: GCUGCCUUGAAGGAGGUGUGGG; scramble for si-LINC00565: GAAACAACUUGUUGC GUGCCC.

Total RNA extraction and quantitative reverse transcriptase polymerase chain reaction

qRT-PCR was performed as previously described,[24] and total RNA was extracted with TRIzol reagent (Invitrogen, USA). After DNase I (Takara, Japan) treatment, the genomic DNA was eliminated. The reverse transcription kit (Takara, Japan) was the tool for RNA reverse transcription, followed by the detection of miRNA, lncRNA, and mRNA levels by SYBR Green Real-Time PCR Master Mix (Takara, Japan). The primers used are manifested in [Table 1]. The relative expression of RNA was analyzed through 2−ΔΔCt. U6 was the internal reference for miRNA expression detection, with GAPDH for lncRNA and mRNA.
Table 1: Primers used in quantitative reverse transcriptase polymerase chain reaction

Click here to view


RNA from the nucleus and cytoplasm was extracted, respectively, using the PARIS kit (Invitrogen, USA). Then, LINC00565 expression in the two locations was evaluated by qRT-PCR.

Cell Counting Kit-8 for cell proliferation detection

The CCK-8 (Yeasen, China) was used to determine cell viability as previously described.[25] Cells were harvested and counted and then plated in 96-well plates with 2 × 103 cells per well. After 0, 24, 48, 72, and 96 h of culture, 10 μl of CCK-8 reagent was added to each well. After 2 h of reaction, the optical density of the solution was measured at 450 nm with a microplate reader (Bio-Rad, USA).

Colony formation assay

This assay was operated as previously described.[24] About 2 × 103 cells were plated in a six-well plate containing 2 ml of culture medium. Cells were incubated in a cell incubator including 5% CO2 at 37°C. The supernatant was decanted 2 weeks later. 100% formaldehyde was added for 15-min fixation, and 0.05% crystal violet (Thermo Fisher, USA) was introduced for 15-min staining. Finally, the number of cell colonies was counted.

Scratch healing assay

Cell migration was assessed by this assay.[26] The density of cell suspension was about 2 × 105 cells/ml. Cells were introduced to six-well plates, with 2 ml of cell suspension per well. After the cells reached almost 90% confluency, a line was drawn with a ruler through the center of the well. The scratched cells were gently rinsed in phosphate-buffered saline (PBS) and then added to a serum-free medium. The scratch status at the beginning and after 24 h of incubation was recorded.

Transwell assay

This assay assessed cell invasion.[26] Matrigel (BD Biosciences, USA) was diluted by medium and then plated to the plate of the upper transwell chamber. After the harvested cells were washed with PBS, they were resuspended in a serum-free medium. Thereafter, approximately 5 × 103 cells were seeded into the upper chamber, with the medium containing 10% FBS introduced to the lower counterpart. After being cultured for 24 h, the cells, as well as the Matrigel in the upper chamber, were removed with a cotton bud. The cells on the other side of the membrane were fixed by formaldehyde and dyed with crystal violet. Finally, cells invading below the membrane were quantified using a microscope.

Dual-luciferase report detection

The assay was performed on the pmirGLO dual luciferase vector (Promega, USA), as described previously.[26] The wild-type (WT) and mutant (MUT) fragments of LINC00565 were cloned into pmirGLO vector to construct the corresponding plasmid. Similarly, ADAM19 mRNA 3'-UTR sequences containing predicted or mutated miR-532-3p binding sites were used to construct the ADAM19-WT and ADAM19-MUT plasmids. The above plasmids were co-transfected into Caki-1 cells with miR-NC and miR-532-3p mimic, respectively. Then, cells were harvested after 48 h, followed by the detection of firefly luciferase and Renilla luciferase activities, respectively, with a dual-luciferase assay kit (Promega, USA). The results were calibrated with Renilla luciferase activity.

Western blot

Radio-immunoprecipitation assay (RIPA) lysis buffer was introduced to cells to extract total proteins. The protein concentration was determined by a bicinchoninic acid kit (Yeasen, China), as described previously.[8] Proteins were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were moved to a polyvinylidene fluoride membrane (Merck Millipore, USA), with the membrane being blocked in skimmed milk. Thereafter, the membrane and primary antibody were incubated at 4°C overnight. The protein bands were then rinsed with Tris-buffered saline plus Tween buffer 3 times, 10 min each. Next, the membrane was reacted with the secondary antibody for 2 h at room temperature. The protein bands were imaged by a chemiluminescent imager (Sagecreation, China). The primary and secondary antibodies were procured from Abcam (UK). Primary antibodies were rabbit antibodies including ADAM19 (ab191457, 1:5000), E-cadherin (ab40772, 1:50000), N-cadherin (ab76011, 1:20000), and vimentin (ab92547, 1:5000). Goat anti-rabbit immunoglobulin G (IgG) (ab6721, 1:20000) served as the secondary antibody.

Argonaute 2 RNA immunoprecipitation

Based on reference,[27] after approximately 1 × 107 cells were washed by PBS, 0.01% formaldehyde was employed for 15 min of cross-linking. RIPA lysis buffer was introduced to the system, followed by centrifugation. The supernatant was collected for RIP by EZ-Magna RIP Kit (Merck Millipore, USA). Protein A/G-coated magnetic beads were incubated with rabbit anti-Argonaute 2 (AGO2) (Abcam, ab186733, 1:30). After the incubation finished, the magnetic beads with antibodies were incubated with the supernatants. The magnetic beads in the control group carried the same amount of IgG (Abcam, ab172730, 1:30) as the experimental group, and were also incubated with the cell lysate supernatant. The incubation lasted overnight at 4°C in a vertical mixing instrument. Beads were obtained after brief centrifugation and then washed. RNA was extracted after proteinase K treatment and then subjected to qRT-PCR.

Statistical analysis

GraphPad Prism 8.0.2 visualized the data of this study, and data were presented as mean ± standard deviation. To compare the expression of genes in different tissues for data that follow a normal distribution, t-tests were used. For data that do not follow a normal distribution, we used non-parametric tests such as the Mann–Whitney test and Kruskal–Wallis test.


  Results Top


To comprehensively reveal the mechanism of LINC00565 in ccRCC at the molecular level, we determined its expression and its impact on cellular functions in ccRCC. The results suggested that LINC00565 was remarkably upregulated in ccRCC tissues and cells, which prominently promoted cell malignant progression. Further bioinformatics approaches confirmed the LINC00565/miR-532-3p/ADAM19 axis, and the cell functional experiments revealed that this axis could facilitate ccRCC cell proliferation. Meanwhile, LINC00565/miR-532-3p/ADAM19 axis could also affect migration and invasion of ccRCC cells via modulating epithelial-mesenchymal transition (EMT), offering a novel target for treating ccRCC.

LINC00565 is strikingly upregulated in ccRCC

The lncRNA expression dataset of ccRCC in TCGA database was downloaded. The expression differences between cancer tissues and normal tissues were analyzed and 2,596 DElncRNAs were acquired [Figure 1]a. Subsequently, we analyzed the dataset in TCGA and found out that LINC00565 was remarkedly upregulated in cancer tissues than in normal tissues [Figure 1]b. Furthermore, LINC00565 has been found to be upregulated in cancer tissues of malignant glioma and OC. It is associated with patients' prognosis, and functions in facilitating cancer cell proliferation, migration, and invasion.[9],[28] We, therefore, selected LINC00565 as the subject of the study. We detected the expression level of LINC00565 in normal human renal tubular epithelial cells (HK-2) and ccRCC cells (OS-RC-2, Caki-1, A498, and 786-O) by qRT-PCR, and the results showed that LINC00565 was highly expressed in ccRCC cells over normal HK-2 cells [Figure 1]c. In summary, LINC00565 level was notably upregulated in ccRCC tissues and cells, suggesting that it might facilitate the malignant progression of ccRCC.
Figure 1: LINC00565 is upregulated in clear cell renal cell carcinoma (ccRCC). (a) The long non-coding RNA (lncRNA) data analysis in ccRCC tissues and normal tissues. Red dots: Differentially upregulated lncRNAs, green dots: Differentially downregulated ones. (b) The differences of LINC00565 expression in ccRCC tissues (red) and normal tissues (green) based on the lncRNA dataset. (c) LINC00565 level in normal human kidney cortical proximal tubular epithelial cell HK-2 and four human RCC cell lines. *P < 0.05.

Click here to view


Knocking down LINC00565 restrains proliferation, migration, and invasion of ccRCC cells

Caki-1 and 786-O were ccRCC cell lines where LINC00565 expression was upregulated. To investigate the role of LINC00565 in ccRCC, we knocked down LINC00565 level through small interfering RNAs. In this process, si-LINC00565-1 manifested a higher transfection efficiency [Figure 2]a. Accordingly, si-LINC00565-1 was selected for subsequent studies. After knocking down LINC00565, the cell proliferation [Figure 2]b, colony formation [Figure 2]c, migration [Figure 2]d, and invasion [Figure 2]e abilities in ccRCC were all restrained. These results suggested that LINC00565 facilitated ccRCC cell progression.
Figure 2: LINC00565 can facilitate the progression of clear cell renal cell carcinoma (ccRCC) cells. (a) The transfection efficiency of small interfering RNAs (siRNAs) in knocking down LINC00565. The siRNA with the highest efficiency was the one for subsequent assays. (b) The proliferation of ccRCC cells after LINC00565 was downregulated. The number of cells was indicated by the optical density (OD) value, and larger OD value indicates more cells. (c) The colony formation of ccRCC cells after LINC00565 was downregulated. (d) The migration of ccRCC cells after LINC00565 was downregulated. The higher the percentage of healing distance, the stronger the migration ability (×40). (e) The invasion of ccRCC cells with downregulated LINC00565 (×100). *P < 0.05.

Click here to view


LINC00565 can directly bind to miR-532-3p

To explore the mechanism of LINC00565 in promoting the proliferation, migration, and proliferation of ccRCC cells, we learned from literature that LINC00565 can induce the proliferation of GA cells through the ceRNA mechanism.[17] The subcellular localization of LINC00565 revealed its expression in both the nucleus and cytoplasm of ccRCC cells. In other words, LINC00565 was able to contact miRNAs [Figure 3]a. Hence, we speculated that LINC00565 might also promote the malignant phenotypes of ccRCC cells through the ceRNA mechanism. To dig out the miRNA that bound to LINC00565, 82 DEmiRNAs in ccRCC were found through TCGA database analysis [Figure 3]b. Next, the downstream miRNAs of LINC00565 were predicted through the lncBase database, and they were intersected with the 31 downregulated DEmiRNAs. Finally, two miRNAs were obtained [Figure 3]c. The two miRNAs were subjected to Pearson correlation analysis with LINC00565. The result showed that miR-532-3p had a higher negative correlation coefficient [Figure 3]d. In the ccRCC dataset of TCGA database, miR-532-3p was significantly downregulated in cancer tissues [Figure 3]e. qRT-PCR revealed that miR-532-3p level was significantly downregulated in ccRCC cells compared with normal epithelial cells [Figure 3]f. After LINC00565 was knocked down, miR-532-3p level in ccRCC cells was significantly enhanced [Figure 3]g, demonstrating that LINC00565 was negatively correlated with miR-532-3p expression.
Figure 3: LINC00565 can target miR-532-3p. (a) The LINC00565 level in the nucleus and cytoplasm. (b) Differential expression analysis on the microRNA (miRNA) dataset of clear cell renal cell carcinoma (ccRCC) in cancer and normal tissues. Red dots: Upregulated miRNAs, green dots: Downregulated ones. (c) The downstream miRNAs of LINC00565 were predicted through the lncBase database. The predicted miRNAs are overlapped with downregulated miRNAs for further screening, with the purple circle indicating downregulated miRNAs and the yellow circle indicating predicted miRNAs. (d) The screened miRNAs were subjected to Pearson correlation analysis with LINC00565. Blue: Negative correlation, red: Positive correlation. (e) MiR-532-3p expression in ccRCC tissues (red) and normal tissues (green). (f) MiR-532-3p expression in normal human kidney cortical proximal tubular epithelial cell line HK-2 and 4 RCC cell lines. (g) Changes in miR-532-3p expression in ccRCC cells after downregulating LINC00565. (h) The transfection efficiency of miR-532-3p mimic. (i) The sequences of the binding site of LINC00565 and miR-532-3p. (j) Validation of the binding of miR-532-3p and LINC00565. WT represents cells transfected with LINC00565-WT while MUT represents cells with LINC00565-MUT. *P < 0.05.

Click here to view


To further validate the relationship between the two, we predicted the binding site of LINC00565 on miR-532-3p through lncBase. We also changed the bases of the binding site to create the sequence of LINC00565-MUT for the dual-luciferase reporter assay [Figure 3]i. After ensuring miR-532-3p was successfully transfected [Figure 3]h, a dual-luciferase reporter plasmid was transfected with ccRCC cells, followed by miR-532-3p transfection. The result indicated that the luciferase activity was strikingly abated in the WT group, not in the MUT group [Figure 3]j. Namely, miR-532-3p specifically targeted a sequence of LINC00565. In sum, LINC00565 was able to directly regulate miR-532-3p.

MiR-532-3p binds the 3'-UTR of ADAM19 to regulate its expression

Our analysis of TCGA dataset revealed 3633 DEmRNAs in ccRCC cells [Figure 4]a. Two thousand four hundred and sixty-eight upregulated DEmRNAs were intersected with the target mRNAs predicted based on starBase, TargetScan, and miRWalk databases. Finally, 10 candidate mRNAs were acquired [Figure 4]b. Their Pearson correlation analyses with LINC00565 unveiled that ADAM19 was positively correlated with LINC00565 with the highest correlation coefficient [Figure 4]c. In TCGA database, ADAM19 was significantly highly expressed in ccRCC tissues [Figure 4]d. The results of qRT-PCR and Western blot assays also suggested the same trend at the cell level [Figure 4]e and [Figure 4]f. TargetScan predicted the binding sites of miR-532-3p and the 3'-UTR of the mRNA ADAM19 [Figure 4]g. Dual-luciferase reporter assay was designed and the result unveiled that miR-532-3p could specifically bind to the 3'-UTR of ADAM19 mRNA [Figure 4]h. Upregulated miR-532-3p in ccRCC resulted in a prominent decrease in the mRNA and protein levels of ADAM19 [Figure 4]i and [Figure 4]j. In sum, miR-532-3p could to the 3'-UTR of ADAM19 mRNA, thereby suppressing ADAM19 expression.
Figure 4: MiR-532-3p targets and modulates ADAM19 expression. (a) Differential expression analysis on cancer and normal tissues in the messenger RNA (mRNA) dataset of clear cell renal cell carcinoma (ccRCC) in The Cancer Genome Atlas. Red dots: Upregulated mRNAs, green dots: Downregulated mRNAs. (b) The targets of miR-532-3p predicted by the starBase, TargetScan, and miRWalk databases. These targets were intersected with upregulated mRNAs. The purple set indicates upregulated mRNAs, the yellow set indicates mRNAs predicted by starBase, the green set indicates mRNAs predicted by TargetScan, and the red set indicates mRNAs predicted by miRWalk. (c) The mRNAs selected in (b) were subjected to Pearson correlation analysis with LINC00565, with blue representing negative correlation and red representing positive correlation. (d) The difference in ADAM19 expression between ccRCC (red) and in normal tissues (green). (e and f) mRNA and protein levels of ADAM19 in normal human kidney epithelial cell line HK-2 and four RCC cell lines. (g) The binding sites for miR-532-3p and mRNA ADAM19. (h) Validation of the binding of miR-532-3p and mRNA ADAM19. WT was cells transfected with luciferase reporter plasmid containing ADAM19-WT sequence and MUT was those containing ADAM19-MUT sequence. (i) The effect of overexpressed miR-532-3p on ADAM19 mRNA expression. (j) The effect of overexpressed miR-532-3p on ADAM19 protein expression. *P < 0.05.

Click here to view


LINC00565 promotes the expression of ADAM19 in ccRCC cells through sponging miR-532-3p

To validate the combination of LINC00565, miR-532-3p, and ADAM19, the enrichment of LINC00565, miR-532-3p, and mRNA ADAM19 was determined through AGO2 RIP. All three were found strikingly enriched [Figure 5]a, indicating that both LINC00565 and mRNA ADAM19 competitively bind miR-532-3p. When LINC00565 level was decreased in ccRCC cells, both mRNA and protein levels of ADAM19 were notably downregulated [Figure 5]b and [Figure 5]c. When the inhibitor of miR-532-3p was transfected into cells containing the downregulated LINC00565, the miR-532-3p up-regulation and ADAM19 downregulation caused by knocking down LINC00565 were eliminated [Figure 5]d and [Figure 5]e. LINC00565 was thereby proven to regulate ADAM19 level through miR-532-3p. Above all, in ccRCC cells, LINC00565 could sponge miR-532-3p and upregulate ADAM19 via the ceRNA mechanism.
Figure 5: LINC00565 can regulate ADAM19 level via miR-532-3p. (a) Enrichment of LINC00565, miR-532-3p, and messenger RNA (mRNA) ADAM19. (b) Effect of downregulated LINC00565 on the mRNA level of ADAM19 in clear cell renal cell carcinoma (ccRCC) cells. (c) The effect of downregulated LINC00565 on ADAM19 protein level in ccRCC cells. (d and e) Changes in ADAM19 mRNA and protein expression. LINC00565 was knocked down by transfecting siRNA, followed by miR-532-3p inhibitor transfection. *P < 0.05.

Click here to view


LINC00565/miR-532-3p/ADAM19 promotes the proliferation and may affect the migration and invasion of ccRCC cells by regulating EMT

LINC00565, miR-532-3p, and ADAM19 built a ceRNA relationship. In order to investigate the cancer-promoting function of this axis, this study performed GSEA on ADAM19 and proved that ADAM19 was prominently enriched on the extracellular matrix (ECM) receptor interaction signaling pathway [Figure 6]a. Since ECM receptor interaction is related to cell adhesion status, and the change of cell adhesion is related to EMT in cancer cells,[29] we speculated that LINC00565 might also regulate EMT in ccRCC. By examining the expression changes in EMT markers, we unveiled that overexpressed ADAM19 reversed the tendency of cancer cells to transform to an epithelial phenotype caused by the downregulation of LINC00565, and restored the high level of mesenchymal phenotypic markers vimentin and N-cadherin [Figure 6]b. Moreover, knocking down LINC00565 and overexpressing ADAM19 also offset the inhibitory effect caused by knocking down LINC00565 on ccRCC cell viability, colony formation, migration, and invasion abilities [Figure 6]c, [Figure 6]d, [Figure 6]e, [Figure 6]f. Namely, LINC00565 could promote the malignant phenotypes of ccRCC cells by regulating ADAM19. Combined with the previous results, LINC00565 modulated ADAM19 expression via sponging miR-532-3p, thereby regulating the progression of ccRCC cells. Furthermore, the facilitating effect of LINC00565 on cancer cell migration and invasion might be achieved through ADAM19-promoted EMT.
Figure 6: LINC00565 promotes the progression and EMT of clear cell renal cell carcinoma (ccRCC) cells through regulating ADAM19 via miR-532-3p. (a) GSEA result of ADAM19. (b) The protein expression of EMT markers. (c) Changes in the proliferation ability of ccRCC cells. LINC00565 was knocked down by transfecting small interfering RNA, followed by overexpressing ADAM19. (d) Changes in the colony formation ability of ccRCC cells. (e) Changes in the migration ability of ccRCC cells (×40). (f) Changes in the invasion ability of ccRCC cells (×100). *P < 0.05.

Click here to view



  Discussion Top


Herein, we found upregulated lncRNA LINC00565 by analyzing TCGA-KIRC dataset. So far, little is known about LINC00565, and there are no relevant studies on the function of LINC00565 in ccRCC. However, the correlation between this lncRNA and cancer progression has been seen. Initially, some studies analyzed that LINC00565 binding with the other five lncRNAs can be deemed as a prognostic marker in malignant gliomas.[28] Later studies explored the function and mechanism of LINC00565 in plenty of cancers. For example, LINC00565 can downregulate KLF9 to promote the proliferation of EC.[8] Targeting GAS6 can enhance the proliferation and metastasis of OC cells.[9] Similarly, this study concluded that LINC00565 also could promote the malignant progression of ccRCC. Besides, ivermectin was proven to inhibit OC progression via lncRNA/EIF4A3/mRNA axis, where lncRNA LINC00565 responds to ivermectin and participates in this axis.[30] This fact indicated that LINC00565 might provide clues for new drug development. In order to provide a theoretical basis for new drug development, we further investigated the mechanism by which LINC00565 promoted cancer progression.

A study reported that LINC00565 is able to target miR-665 and regulate AKT3 through ceRNA mechanism, thereby promoting the proliferation and inhibiting apoptosis of GC cells.[17] The study suggested that LINC00565 can function in multiple ways, which inspired our research. Thus, we performed bioinformatics analysis and cellular assays and confirmed that LINC00565 could bind to miR-532-3p, thereby downregulating miR-532-3p level, making it difficult for miR-532-3p to suppress cancer progression. Several studies have proved that miR-532-3p can target mRNAs of multiple proteins, such as ETS1, TGM2,[31] KIFC1,[32] and HMGA2.[33] The malignant process of various cancers such as colon cancer, hepatocellular carcinoma, and lung cancer was thereby inhibited. Furthermore, miR-532-3p can target AQP9, thus attenuating the migration and invasion ability of ccRCC.[34] This study further proved that in ccRCC, miR-532-3p also targeted ADAM19, deepening the understanding of the mechanism of miR-532-3p. The downstream effectors by which LINC00565 promoted cancer progression were identified.

As previously reported, ADAM12 is overexpressed in ccRCC and is linked to poor prognosis as well as immune cell infiltration and may be a potential prognostic biomarker in ccRCC.[35] The ADAM family is a group of membrane-anchored glycoproteins that primarily function in neurogenesis, fertilization, Alzheimer's disease, angiogenesis, and releasing proteins such as epidermal growth factor receptor ligands and tumor necrosis factor family members.[36] ADAM19, also known as Meltrin-β, works in forming neurons and breaking down neuregulin.[37] ADAM19 participates in ECM degradation and is suggested as a biomarker of EMT, which is associated with the migration and invasion of cancer cells.[38],[39] Thereafter, ADAM19 was proven to be involved in cancer progression. In lung cancer[21] and malignant glioma,[40] ADAM19 is highly expressed and promotes malignant phenotypes such as proliferation, migration, and EMT of cancer cells. In this study, ADAM19 was targeted by miR-532-3p. Similarly, ADAM19 promoted the malignant progression of ccRCC and was regulated by the ceRNA mechanism constituted by LINC00565 and miR-532-3p. There were also miRNAs previously found to target ADAM19, thereby affecting cancer development, such as miR-145.[41] miR-153,[20] and miR-30c.[42] The LINC00565/miR-532-3p/ADAM19 axis identified in this study concatenates past studies to provide a basis for an in-depth study of regulatory networks about the malignant phenotypes such as migration and invasion in ccRCC cells. This regulatory axis provides a new entry to the search for therapeutic targets for ccRCC, while the axis itself could also be a therapeutic target.

MiR-532-3p, a tumor suppressor proven in this and several past studies, was found to be highly expressed in BC and hepatocellular carcinoma, and the migration and invasion of cancer cells are inhibited when miR-532-3p expression is silenced.[43],[44] Further validation is thus needed in different cancers. A profound understanding of LINC00565/miR-532-3p/ADAM19 regulatory network was required in order to utilize this in drug development.


  Conclusion Top


Our study verified that lncRNA LINC00565 was upregulated in ccRCC tissues and cells and regulated the progression of ccRCC cells via the miR-532-3p/ADAM19 axis. However, we only performed in vitro experiments to validate the role and regulatory mechanism of the LINC00565/miR-532-3p/ADAM19 axis in ccRCC cells. We also need to generate a xenograft model using lowly expressed LINC00565 to further verify the way LINC00565/miR-532-3p/ADAM19 axis affects ccRCC progression. Clinical data are also required to comprehensively analyze the expression and correlation of LINC00565, miR-532-3p, and ADAM19 in ccRCC patient samples.

Data availability statement

The data and materials in the current study are available from the corresponding author on reasonable request.

Author contributions

Bin Meng: Conceptualization, Methodology, Writing - Original Draft. Pengfei Wang: Validation, Visualization. Chaofei Zhao: Validation, Formal analysis. Guangwei Yin: Investigation, Resources. Xin Meng: Data Curation, Investigation. Lin Li: Visualization, Writing - Original Draft. Shengyong Cai: Data Curation, Writing - Review & Editing. Chengquan Yan: Writing - Review & Editing, Project administration.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Capi,tanio U, Montorsi F. Renal cancer. Lancet 2016;387:894-906.  Back to cited text no. 1
    
2.
Linehan WM, Ricketts CJ. The cancer genome atlas of renal cell carcinoma: Findings and clinical implications. Nat Rev Urol 2019;16:539-52.  Back to cited text no. 2
    
3.
Patard JJ, Pignot G, Escudier B, Eisen T, Bex A, Sternberg C, et al. ICUD-EAU international consultation on kidney cancer 2010: Treatment of metastatic disease. Eur Urol 2011;60:684-90.  Back to cited text no. 3
    
4.
Loo V, Salgia M, Bergerot P, Philip EJ, Pal SK. First-line systemic therapy for metastatic clear-cell renal cell carcinoma: Critical appraisal of emerging options. Target Oncol 2019;14:639-45.  Back to cited text no. 4
    
5.
Shah AY, Kotecha RR, Lemke EA, Chandramohan A, Chaim JL, Msaouel P, et al. Outcomes of patients with metastatic clear-cell renal cell carcinoma treated with second-line VEGFR-TKI after first-line immune checkpoint inhibitors. Eur J Cancer 2019;114:67-75.  Back to cited text no. 5
    
6.
Zhao J, Xu J, Shang AQ, Zhang R. A six-lncRNA expression signature associated with prognosis of colorectal cancer patients. Cell Physiol Biochem 2018;50:1882-90.  Back to cited text no. 6
    
7.
Song P, Jiang B, Liu Z, Ding J, Liu S, Guan W. A three-lncRNA expression signature associated with the prognosis of gastric cancer patients. Cancer Med 2017;6:1154-64.  Back to cited text no. 7
    
8.
Yin X, Li X, Feng G, Qu Y, Wang H. LINC00565 enhances proliferative ability in endometrial carcinoma by downregulating KLF9. Onco Targets Ther 2020;13:6181-9.  Back to cited text no. 8
    
9.
Gong M, Luo C, Meng H, Li S, Nie S, Jiang Y, et al. Upregulated LINC00565 accelerates ovarian cancer progression by targeting GAS6. Onco Targets Ther 2019;12:10011-22.  Back to cited text no. 9
    
10.
Shao X, Zhao T, Xi L, Zhang Y, He J, Zeng J, et al. LINC00565 promotes the progression of colorectal cancer by upregulating EZH2. Oncol Lett 2021;21:53.  Back to cited text no. 10
    
11.
Wu XS, Wang F, Li HF, Hu YP, Jiang L, Zhang F, et al. LncRNA-PAGBC acts as a microRNA sponge and promotes gallbladder tumorigenesis. EMBO Rep 2017;18:1837-53.  Back to cited text no. 11
    
12.
Yang J, Qiu Q, Qian X, Yi J, Jiao Y, Yu M, et al. Long noncoding RNA LCAT1 functions as a ceRNA to regulate RAC1 function by sponging miR-4715-5p in lung cancer. Mol Cancer 2019;18:171.  Back to cited text no. 12
    
13.
Qi X, Zhang DH, Wu N, Xiao JH, Wang X, Ma W. ceRNA in cancer: Possible functions and clinical implications. J Med Genet 2015;52:710-8.  Back to cited text no. 13
    
14.
Han M, Yan H, Yang K, Fan B, Liu P, Yang H. Identification of biomarkers and construction of a microRNA-mRNA regulatory network for clear cell renal cell carcinoma using integrated bioinformatics analysis. PLoS One 2021;16:e0244394.  Back to cited text no. 14
    
15.
Gao B, Wang L, Zhang Y, Zhang N, Han M, Liu H, et al. MiR-532-3p suppresses cell viability, migration and invasion of clear cell renal cell carcinoma through targeting TROAP. Cell Cycle 2021;20:1578-88.  Back to cited text no. 15
    
16.
Li X, Zheng P, Ji T, Tang B, Wang Y, Bai S. LINC00052 ameliorates acute kidney injury by sponging miR-532-3p and activating the Wnt signaling pathway. Aging (Albany NY) 2020;13:340-50.  Back to cited text no. 16
    
17.
Hu J, Ni G, Mao L, Xue X, Zhang J, Wu W, et al. LINC00565 promotes proliferation and inhibits apoptosis of gastric cancer by targeting miR-665/AKT3 axis. Onco Targets Ther 2019;12:7865-75.  Back to cited text no. 17
    
18.
Sun L, Chen B, Wu J, Jiang C, Fan Z, Feng Y, et al. Epigenetic regulation of a disintegrin and metalloproteinase (ADAM) transcription in colorectal cancer cells: Involvement of β-catenin, BRG1, and KDM4. Front Cell Dev Biol 2020;8:581692.  Back to cited text no. 18
    
19.
Sun Z, Zhang A, Jiang T, Du Z, Che C, Wang F. MiR-145 suppressed human retinoblastoma cell proliferation and invasion by targeting ADAM19. Int J Clin Exp Pathol 2015;8:14521-7.  Back to cited text no. 19
    
20.
Shan N, Shen L, Wang J, He D, Duan C. MiR-153 inhibits migration and invasion of human non-small-cell lung cancer by targeting ADAM19. Biochem Biophys Res Commun 2015;456:385-91.  Back to cited text no. 20
    
21.
Li J, Xu X, Wei C, Liu L, Wang T. Long noncoding RNA NORAD regulates lung cancer cell proliferation, apoptosis, migration, and invasion by the miR-30a-5p/ADAM19 axis. Int J Clin Exp Pathol 2020;13:1-13.  Back to cited text no. 21
    
22.
Zhou Q, Guo J, Huang W, Yu X, Xu C, Long X. Linc-ROR promotes the progression of breast cancer and decreases the sensitivity to rapamycin through miR-194-3p targeting MECP2. Mol Oncol 2020;14:2231-50.  Back to cited text no. 22
    
23.
Robinson MD, McCarthy DJ, Smyth GK. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010;26:139-40.  Back to cited text no. 23
    
24.
Kong X, Duan Y, Sang Y, Li Y, Zhang H, Liang Y, et al. LncRNA-CDC6 promotes breast cancer progression and function as ceRNA to target CDC6 by sponging microRNA-215. J Cell Physiol 2019;234:9105-17.  Back to cited text no. 24
    
25.
Luan X, Wang Y. LncRNA XLOC_006390 facilitates cervical cancer tumorigenesis and metastasis as a ceRNA against miR-331-3p and miR-338-3p. J Gynecol Oncol 2018;29:e95.  Back to cited text no. 25
    
26.
Zhang J, Lv W, Liu Y, Fu W, Chen B, Ma Q, et al. LINC_00355 promotes gastric cancer progression by upregulating PHF19 expression through sponging miR-15a-5p. BMC Cancer 2021;21:657.  Back to cited text no. 26
    
27.
Lee WJ, Shin CH, Ji H, Jeong SD, Park MS, Won HH, et al. hnRNPK-regulated LINC00263 promotes malignant phenotypes through miR-147a/CAPN2. Cell Death Dis 2021;12:290.  Back to cited text no. 27
    
28.
Liang R, Zhi Y, Zheng G, Zhang B, Zhu H, Wang M. Analysis of long non-coding RNAs in glioblastoma for prognosis prediction using weighted gene co-expression network analysis, Cox regression, and L1-LASSO penalization. Onco Targets Ther 2019;12:157-68.  Back to cited text no. 28
    
29.
Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. Nat Rev Cancer 2009;9:265-73.  Back to cited text no. 29
    
30.
Li N, Zhan X. Anti-parasite drug ivermectin can suppress ovarian cancer by regulating lncRNA-EIF4A3-mRNA axes. EPMA J 2020;11:289-309.  Back to cited text no. 30
    
31.
Gu C, Cai J, Xu Z, Zhou S, Ye L, Yan Q, et al. MiR-532-3p suppresses colorectal cancer progression by disrupting the ETS1/TGM2 axis-mediated Wnt/β-catenin signaling. Cell Death Dis 2019;10:739.  Back to cited text no. 31
    
32.
Han J, Wang F, Lan Y, Wang J, Nie C, Liang Y, et al. KIFC1 regulated by miR-532-3p promotes epithelial-to-mesenchymal transition and metastasis of hepatocellular carcinoma via gankyrin/AKT signaling. Oncogene 2019;38:406-20.  Back to cited text no. 32
    
33.
Han X, Huang T, Han J. Long noncoding RNA VPS9D1-AS1 augments the malignant phenotype of non-small cell lung cancer by sponging microRNA-532-3p and thereby enhancing HMGA2 expression. Aging (Albany NY) 2020;12:370-86.  Back to cited text no. 33
    
34.
Yamada Y, Arai T, Kato M, Kojima S, Sakamoto S, Komiya A, et al. Role of pre-miR-532 (miR-532-5p and miR-532-3p) in regulation of gene expression and molecular pathogenesis in renal cell carcinoma. Am J Clin Exp Urol 2019;7:11-30.  Back to cited text no. 34
    
35.
Gao J, Yang D, Xu H, Yang K, Ma J, Xia J, et al. ADAM metallopeptidase domain 12 overexpression correlates with prognosis and immune cell infiltration in clear cell renal cell carcinoma. Bioengineered 2022;13:2412-29.  Back to cited text no. 35
    
36.
Zhou HM, Weskamp G, Chesneau V, Sahin U, Vortkamp A, Horiuchi K, et al. Essential role for ADAM19 in cardiovascular morphogenesis. Mol Cell Biol 2004;24:96-104.  Back to cited text no. 36
    
37.
Mochizuki S, Okada Y. ADAMs in cancer cell proliferation and progression. Cancer Sci 2007;98:621-8.  Back to cited text no. 37
    
38.
Peixoto P, Etcheverry A, Aubry M, Missey A, Lachat C, Perrard J, et al. EMT is associated with an epigenetic signature of ECM remodeling genes. Cell Death Dis 2019;10:205.  Back to cited text no. 38
    
39.
De Craene B, Berx G. Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer 2013;13:97-110.  Back to cited text no. 39
    
40.
Wang X, Wang E, Cao J, Xiong F, Yang Y, Liu H. MiR-145 inhibits the epithelial-to-mesenchymal transition via targeting ADAM19 in human glioblastoma. Oncotarget 2017;8:92545-54.  Back to cited text no. 40
    
41.
Wang Y, Lian YM, Ge CY. MiR-145 changes sensitivity of non-small cell lung cancer to gefitinib through targeting ADAM19. Eur Rev Med Pharmacol Sci 2019;23:5831-9.  Back to cited text no. 41
    
42.
Zhang Q, Yu L, Qin D, Huang R, Jiang X, Zou C, et al. Role of microRNA-30c targeting ADAM19 in colorectal cancer. PLoS One 2015;10:e0120698.  Back to cited text no. 42
    
43.
Liu M, Luo C, Dong J, Guo J, Luo Q, Ye C, et al. CircRNA_103809 suppresses the proliferation and metastasis of breast cancer cells by sponging microRNA-532-3p (miR-532-3p). Front Genet 2020;11:485.  Back to cited text no. 43
    
44.
Wang Y, Yang Z, Wang L, Sun L, Liu Z, Li Q, et al. miR-532-3p promotes hepatocellular carcinoma progression by targeting PTPRT. Biomed Pharmacother 2019;109:991-9.  Back to cited text no. 44
    

Top
Correspondence Address:
Chengquan Yan,
Department of Urology, Area 3, Tangshan Gongren Hospital, No. 27 Wenhua Road, Lubei District, Tangshan 063000
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/cjop.CJOP-D-23-00078



    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]
 
 
    Tables

  [Table 1]



 

Top
 
  Search
 
   Ahead Of Print
  
 Article in PDF
     Search Pubmed for
 
    -  Meng B
    -  Wang P
    -  Zhao C
    -  Yin G
    -  Meng X
    -  Li L
    -  Cai S
    -  Yan C


Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed141    
    PDF Downloaded1    

Recommend this journal