|
| |
 |
|
| ORIGINAL ARTICLE |
|
| Year : 2019 | Volume
: 62
| Issue : 4 | Page : 139-147 |
|
Adenine decreases hypertrophic effects through interleukin-18 receptor
Yi-Feng Yang, Yao-Jen Liang
Graduate Institute of Applied Science and Engineering; Department and Institute of Life Science, Fu-Jen Catholic University, Taipei, Taiwan
| Date of Submission | 20-Feb-2019 |
| Date of Decision | 10-Jul-2019 |
| Date of Acceptance | 07-Aug-2019 |
| Date of Web Publication | 29-Aug-2019 |
Correspondence Address:
Dr. Yao-Jen Liang
Graduate Institute of Applied Science and Engineering, Fu-Jen Catholic University, No. 510 Zhongzheng Road, Xinzhuang District, New Taipei City 24205
Taiwan
 Source of Support: None, Conflict of Interest: None  | 2 |
DOI: 10.4103/CJP.CJP_18_19
Cardiac hypertrophy is the main cause of heart failure. Levels of circulating interleukin-18 (IL-18) have been reported to increase in congestive heart disease and cardiac hypertrophy. Relationships among IL-18 levels, IL-18 receptor (IL-18R) expression, and cardiac hypertrophy remain unclear. IL-18 can induce cardiac hypertrophy in cardiomyoblasts. We also studied IL-18R messenger RNA (mRNA) and protein expression through quantitative-polymerase chain reaction and Western blotting. Furthermore, we treated cardiomyoblasts with adenine, gold nanoparticles (AuNPs), and inhibitors to analyze the morphology and identify signaling pathways involved in cardiac hypertrophy. Moreover, we studied the effects of IL-18R small interfering RNA (siRNA) on signaling pathways through Western blotting. The mRNA expression of IL-18R in H9c2 cardiomyoblasts, which was induced by IL-18, increased significantly after 8 h, and the protein level increased significantly after 15 h. Morphological examination of H9c2 cardiomyoblasts showed that cell volume and cell diameter decreased after adenine pretreatment. Both p38 MAPK and PI3 kinase are biomarkers in the pathway correlated with cardiac hypertrophy. After treatment with inhibitors SB203580 and LY294002, the levels of p38 MAPK and PI3 kinase, respectively, decreased along with cell size and IL-18R expression. Treatment with adenine, but not AuNPs, reduced the levels of phosphorylated p38 and PI3 kinase expression more effectively than did treatment with the respective inhibitors alone. IL-18R siRNA significantly reduced cell size but not PI3 kinase expression and phosphorylation of p38 MAPK. However, adenine treatment reduced PI3 kinase expression after treatment with IL-18R siRNA. In this study, IL-18 induced cardiomyoblast hypertrophy through IL-18R upregulation, which was found to be related to p38 MAPK and PI3 kinase signaling. Adenine, but not AuNPs, showed antihypertrophic effects possibly because of decreased levels of signaling.
Keywords: Adenine, cardiac hypertrophy, gold nanoparticles, interleukin-18 receptor, p38 MAPK, PI3 kinase
How to cite this article:
Yang YF, Liang YJ. Adenine decreases hypertrophic effects through interleukin-18 receptor. Chin J Physiol 2019;62:139-47 |
| Introduction | |  |
Cardiac hypertrophy is a type of cardiomyopathy. It is defined as thickening of the interventricular wall, septum, and increase in myocardial mass.[1],[2],[3] Moreover, it can be a risk factor for heart failure. Morphologically, cardiac hypertrophy is characterized by enlargement of cardiomyocytes.[3]
Interleukin-18 (IL-18), originally defined as an interferon-γ-inducing factor, is a pro-inflammatory cytokine that belongs to the IL-1 family and is expressed in some cells including macrophages, Kuffer cells, and keratinocytes.[4],[5],[6] IL-18 also plays a crucial role in various heart diseases, including myocardial ischemia, infarction, and myocarditis. Recent studies have indicated that the levels of circulating IL-18 increase in congestive heart disease and cardiac hypertrophy.[7] Mature IL-18 can bind its cognate receptor, namely IL-18 receptor (IL-18R), to exert its biological activities and perform signaling.[6],[8] IL-18R is a heterodimeric receptor comprising a binding α subunit and signaling β subunit.[6] IL-18/IL-18R may be involved in cardiac hypertrophy through the following pathway: PI3 kinase → Akt → GATA4/atrial natriuretic peptide. Some studies have shown that IL-18 can advance the activities of MAPK, including p38 MAPK and extracellular regulated kinase 1/2, in human natural killer cells.[9]
Gold nanoparticles (AuNPs) have been extensively studied for various applications in the field of medicine. Nanotechnology is being used to develop treatments combining AuNPs and cardiotropic drug release to improve the clinical potency of currently available drugs in treating patients with heart failure.[10] AuNPs also have been reported to exhibit a cardioprotective effect on rats with heart failure.[11]
AMP-activated protein kinase, AMPK, is a heterotrimeric complex consisting of a catalytic α subunit, regulatory β subunit, and γ subunit. It is also a serine-threonine kinase that plays the role of an energy sensor in different cell types. Thus, AMPK can play a significant role in cardioprotection.[12],[13] Furthermore, AMPK in pharmacological activation suppresses the mTOR pathway as well as regulates the process of cardiac hypertrophy.[13] Accordingly, AMPK may be used in therapy for cardiac hypertrophy and heart function.
Some effects of AMPK and AuNPs in treating various heart diseases, including cardiac hypertrophy, are known. Furthermore, the expression of IL-18R induced by IL-18 is known to be associated with hypertrophy and myocardial dysfunction. Therefore, our hypothesis was that an AMPK activator (adenine)[14] and AuNPs affect the cell size and the process of cardiac hypertrophy related to IL-18R. We also compared the antihypertrophic effects of adenine and AuNPs in this study.
| Materials and Methods | | |
Cell culture and treatment
H9c2 cells, originating from the embryonic rat heart, were cultured in the Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 1% Antibiotic-Antimycotic solution (HiMedia) at 37°C and 5% CO2 in 100 mm dishes. For different experiments, H9c2 cells were seeded in 60 mm dishes. After the cells reached 70%–80% confluency, the cells were treated with IL-18 (0.3 μg/ml) (Sigma-Aldrich), AuNPs (1 ppm), adenine (200 μM), or combinations of these. The inhibitors (SB203580 and LY294002) (Enzo Life Sciences) were dissolved in dimethyl sulfoxide (Sigma-Aldrich). The concentrations were 20 μM and 50 μM, respectively.[7],[15]
RNA extraction
RNA isolation followed the Invitrogen™ TRIzol Reagent (Thermo Fisher Scientific) manufacturer's instructions. At about 70%–80% confluency, we lysed H9c2 cells by 0.5 ml of TRIzol Reagent and subsequently added 0.5 ml of chloroform (Sigma-Aldrich) per 0.5 ml of TRIzol Reagent for lysis. After the samples were mixed for 15 s, the samples were centrifuged at 13,200 rpm at 4°C for 15 min, and we transferred the upper aqueous phase into new tubes. For precipitating RNA, the isopropyl alcohol (Sigma-Aldrich) was used 0.5 ml/1 ml of TRIzol Reagent. The samples were centrifuged 13,200 rpm at 4°C for 10 min, and the supernatant was removed completely. The RNA pellets were washed by 1 ml of 75% ethanol per 1 ml of TRIzol Reagent. We mixed the samples and centrifuged 13,200 rpm at 4°C for 10 min. Finally, the RNA pellets were air-dried for 5–10 min and RNA pellets dissolved in 20 μl DEPC-treated water (Sigma-Aldrich). We diluted 5 μl of RNA with 495 μl of DEPC-treated water (1:100) for OD measurement. We measured OD at 260 nm and 280 nm to determine sample concentration and purity. The ratio of A260/A280 should be above 1.6. We applied the convention that 1 OD at 260 equals 40 μg/ml RNA.[16]
Reverse transcriptase-polymerase chain reaction
We followed the steps described in the Hiscript I Reverse Transcriptase (BIONOVAS biotechnology) manufacturer's protocol. The first step was forFirst-Strand cDNA synthesis. It needed the following components containing Oligo dT primer (50 pmole)/Random primer (50 pmole), RNA template (3 μg), and dNTP mixture (10 mM). The components were added to DEPC water and heated at 65°C for 5 min and cooled subsequently. For preparing the reaction mixture, it required to mix the following reagents containing template RNA/Primer mixture, 5X first-strand buffer, DTT (0.1 M), DEPC water, and HiScript I Reverse Transcriptase. The reaction was performed under the following condition, including 30°C (10 min) → 42°C (30–60 min). Incubation at 70°C for 15 min was the final step of cDNA synthesis. The second step was for polymerase chain reaction (PCR). We added the following components containing 10 × PCR Buffer, dNTPs Mixture (10 mM), IL-18R primer (10 μM) (Forward: TGCTCTGTTTGGGCTGGGTGTTT, Reverse: TAGTGGACCGCCACTCCGAGG), Taq DNA polymerase (5U/μl), and theFirst-Strand reactant. Finally, PCR was performed for 20–40 cycles. PCR products were analyzed by 5% agarose gel stained with ethidium-bromide and visualized under ultraviolet illumination.[17]
Real-time-quantitative polymerase chain reaction PCR
The cDNA was performed by 10 μM IL-18R primer (Forward: TGCTCTGTTTGGGCTGGGTGTTT, Reverse: TAGTGGACCGCCACTCCGAGG), 10 μM GAPDH primer (Forward: AGACAGCCGCATCTTCTTGT, Reverse: TTCCCATTCTCAGCCTTGAC), 2× IQ2 SYBR Green Fast qPCR System Master Mix (Bio-Genesis Technologies), and ddH2O. The mixture was compatible with two steps cycling procedures. The first step was polymerase activation at 95°C for 2 min in 1 cycle. The second step was denaturation at 95°C for 5 s. The parts of annealing and extension were at 60°C for 15 s in 40 cycles. The results were measured by StepOne™ real-time PCR System (Applied Biosystems). The data were normalized by GAPDH and expressed as the relative ratio to control.
Western blot analysis
Total protein samples were extracted from H9c2 cells by PRO-PREP™ Protein Extraction Solution (iNtRON Biotechnology). Protein samples were separated by 10% SDS polyacrylamide gels electrophoresis and then transferred to PVDF membranes (Immobilon-P transfer membrane; Millipore). The PVDF membranes were blocked with 5% nonfat milk in PBST, and the membranes were incubated with polyclonal rabbit IL-18R antibody (1:2500 dilution; Santa Cruz Biotechnology), polyclonal rabbit PI3kinase antibody (1:2500 dilution; GeneTex), monoclonal mouse p-p38 MAPK antibody (1:2500 dilution; Santa Cruz Biotechnology), monoclonal mouse p38 MAPK (1:2,500 dilution; GeneTex), and monoclonal mouse β-actin antibody (1:5,000 dilution; Santa Cruz Biotechnology) overnight. After the PVDF membranes were washed by PBST, the membranes were probed with anti-mouse immunoglobulin G - horseradish peroxidase (IgG-HRP) secondary antibodies (1:5,000 dilution; GeneTex) and anti-rabbit IgG-HRP secondary antibodies (1:5,000 dilution; GeneTex). Immunoreactive bands were visualized by LumiFlash™ Infinity Chemiluminescent Substrate (Visual Protein).[17]
Cell hypertrophy analysis
H9c2 cell lines were seeded in 60 mm dishes for drug treatment. After drug treatment, single-cell suspensions were made, and we diluted the cells to 10,000–500,000 cells/ml with PBS. Then, the diluted cells were measured by the Scepter™ Handheld Automated Cell Counter (Millipore) to determine mean cell volume and mean cell diameter. Results were analyzed with Scepter Software Pro 2.1 (Millipore, Burlington, Massachusetts, United States).[18]
RNA silence
For IL-18R small interfering RNA (siRNA) (Santa Cruz Biotechnology) transfection, myoblasts were seeded in 60 mm dishes before transfection. When the cells were grown to 70%–80% confluency, the cells were transfected by TWENTY (2 μl), testing transfection reagent, with the IL-18R siRNA (1 μg) for 8 h. After transfection of IL-18R siRNA, the transfected cells were treated by indicated drugs.
Statistical analysis
All results are presented as mean ± standard error of mean. All statistical analyses were performed by SPSS software (Statistical Product and Service Solutions, IBM). Differences between experimental groups were analyzed by LSD test. P < 0.05 was considered statistically significance.
| Results | | |
Interleukin-18 induced interleukin-18 receptor
To identify the relationship between IL-18R and cardiac hypertrophy, we first examined IL-18R messenger RNA (mRNA) expression in H9c2 cells. We determined the basal level of IL-18R mRNA expression in H9c2 cells [Figure 1]a. Next, we studied IL-18R expression at different time intervals following IL-18 treatment. Results showed that IL-18R mRNA expression increased significantly in the 8th h [Figure 1]b. Furthermore, IL-18R protein expression in H9c2 cells significantly increased in the 15th and 18th h after IL-18 treatment [Figure 1]c. These results demonstrated that IL-18R expression was upregulated after IL-18 treatment. | Figure 1: Interleukin-18 receptor expression in H9c2 cardiomyoblasts treated with interleukin-18. (a) After interleukin-18 treatment, interleukin-18 receptor mRNA is found in H9c2 cells. (b) The messenger RNA expression of interleukin-18 receptor is indicated in different duration including 8, 15, 18, and 24 h in the groups of H9c2 induced via interleukin-18. (c) After H9c2 cell line treated by interleukin-18, interleukin-18 receptor protein expression is shown at various time points (8, 15, 18, and 24 h). **P < 0.05, compared with control
Click here to view |
Drugs treatment affected diameter and volume of H9c2 cell
We next investigated the relationship between IL-18R expression and cell size. Results showed that the diameter and volume of cells increased significantly in IL-18-treated cells, and the diameter and volume of cells decreased for cells treated with adenine+IL-18 but not for those treated with AuNPs+ IL-18 [Figure 2]a and [Figure 2]b. AuNPs treatment inhibited the IL-18-induced increase in cell size, but AuNPs-treated cells were not significantly smaller than IL-18-treated cells. These results indicated that adenine affects the IL-18-induced increase in cell volume in H9c2 cells. Thus, adenine is more potent than AuNPs. | Figure 2: Cell size in response to interleukin-18, gold nanoparticles, and adenine treatment. (a and b) Cell diameter (n = 5) and cell volume (n = 6) of H9c2 after treatment with interleukin-18, or combinations of gold nanoparticles+interleukin-18 and adenine+interleukin-18.**P < 0.05, compared with control *P < 0.05, compared with interleukin-18
Click here to view |
Cell size and interleukin-18 receptor downstream signaling
Mitogen-activated protein kinases play a crucial regulatory role in approximately every aspect of cell biology. Its family consists of four main serine/threonine protein kinases subfamilies. In response to various stress stimuli, MAPKs transmit extracellular signals to intracellular targets, thereby mediating the survival, function, growth, and differentiation of cells.[19],[20] We pretreated cells with SB203580, a p38 inhibitor, to investigate the effects on cell size and those of IL-18R upregulation. Our results demonstrated that after pretreatment with SB203580, the size of SB203580-treated cells was significantly smaller than that of IL-18-treated cells [Figure 3]a and [Figure 3]b. IL-18R protein expression increased significantly in IL-18-treated cells and was significantly attenuated in cells that were pretreated with SB203580 [Figure 3]c. We also studied the ratio of phosphor-p38 to total p38 MAPK expression in drug treated-cells. These results showed that adenine, but not AuNPs, significantly reduced the ratio of phosphor-p38 MAPK to p38 MAPK [Figure 3]d. These results indicated that IL-18 increased the size of H9c2 cells; this effect may be related to p38 MAPK signaling of IL-18R upregulation. Furthermore, results showed that the mechanism of action of adenine, but not AuNPs, may include effects on p38 signaling. | Figure 3: Expression of p38 MAPK, interleukin-18 receptor, and cell size after the H9c2 cells were treated with the SB203580 (SB) and drugs. (a and b) Interleukin-18 significantly increased H9c2 cell size which was attenuated by SB pretreatment. (c) Pretreatment with SB significantly decreased the interleukin-18-induced increases in interleukin-18 receptor protein expression (n = 6). (d) Adenine (Ade) but not gold nanoparticles (Au) significantly augment phosphor-p38 MAPK and p38 MAPK ratio inhibition by SB pretreatment. (n = 4) ##P < 0.01, compared with control #P < 0.01, compared with interleukin-18 **P < 0.05, compared with control * P < 0.05, compared with SB+interleukin-18
Click here to view |
Diameter, volume, and interleukin-18 receptor expression after LY294002 treatment in H9c2 cell
Phosphoinositide 3-kinase, also known as PI3 kinase or PI3K, was initially considered to exhibit a minor inositol lipid kinase activity that was correlated with immunoprecipitated oncogene products. PI3 kinase has been subsequently found to be related to a distinct series of cellular functions, involving growth, proliferation, mobility, differentiation, survival, and trafficking.[21] PI3 kinase signaling may be another signaling pathway related to hypertrophy. Cells were pretreated using LY294002, a signaling inhibitor of PI3 kinase, before treating them with the drug. Results showed that compared with IL-18-treated cells, those treated with LY294002+IL-18 exhibited significantly smaller cell volume and diameter [Figure 4]a and [Figure 4]b. IL-18R protein expression was lower in cells treated with LY294002+IL-18 than in cells treated with IL-18 treated alone [Figure 4]c. Cells treated with LY294002+IL-18, LY294002+AuNPs+IL-18, and LY294002+adenine+IL-18 all exhibited a significant decrease in PI3 kinase expression [Figure 4]d. Results indicated that PI3 kinase signaling might be related to the IL-18R pathway and H9c2 cell hypertrophy. | Figure 4: PI3 kinase signaling and interleukin-18 receptor upregulation. (a and b) Pre-treated with LY294002 (LY) significantly attenuated interleukin-18-induced H9c2 cell size increase. (c) Interleukin-18 significantly increases interleukin-18 receptor protein expression which was blunted by LY. (d) Adenine (Ade) and gold nanoparticles (Au) treatments significantly augment PI3 kinase inhibition by LY pretreatment. (n = 6) ##P < 0.01, compared with control #P < 0.01, compared with interleukin-18 **P < 0.05, compared with control
Click here to view |
Blockaded interleukin-18 receptor by interleukin-18 receptor small interfering RNA
We pretreated cells with IL-18R siRNA to knock down IL-18R and studied cell size and hypertrophy-associated protein expression. Pretreatment with IL-18R siRNA reduced cell diameter and volume significantly [Figure 5]a and [Figure 5]b. These results showed that IL-18R signaling was involved in cardiac hypertrophy. Cells treated using IL-18R siRNA+adenine+IL-18 exhibited a significant decrease in PI3 kinase protein expression but not cells treated using IL-18R siRNA+AuNPs+IL-18 [Figure 6]a. However, none of the treatment groups showed a significant decrease in phosphor-p38 protein expression [Figure 6]b. | Figure 5: Interleukin 18 receptor small interfering RNA (siIL-18R) significantly decreased interleukin-18-induced H9c2 (a) cell diameter (n = 4) and (b) cell volume. (n = 4) **P < 0.05, compared with control
Click here to view |
 | Figure 6: PI3 kinase expression and p38 MAPK phosphorylation after interleukin 18 receptor small interfering RNA (siIL-18R) treatment. (a) siIL-18R with adenine (Ade) cotreatment significantly decreased PI3 kinase expression. (b) Pretreated siIL-18R and/or gold nanoparticles (Au) and Ade did not decrease the ratio of phosphor-p38 MAPK to p38. (n = 4) *P < 0.05, compared with siIL-18R+interleukin-18
Click here to view |
| Discussion | | |
Circulating IL-18 levels are increased in patients with congestive heart failure.[22] Previous studies have proven that IL-18 is a prohypertrophy cytokine,[7] and IL-18 might be a target in myocardial infarction and heart failure therapy.[23] IL-18R induced by IL-18 is related to heart diseases, including cardiac hypertrophy. This study demonstrated that cardiac hypertrophy is related to IL-18-induced IL-18R upregulation through p38 MAPK and PI3 kinase, and the antihypertrophic effect of adenine treatment is related to PI3 kinase inhibition.
Accordingly, the study shows that the expression of IL-18 and IL-18Rα upregulates the end phase of heart failure in human.[24] Thus, the expression of IL-18Rα also enhances myocardium failure in patients with either dilated or ischemic cardiomyopathy.[25] Previous studies have shown that AuNPs, 30 nm in size, can exert a cardioprotective effect on rats with heart failure.[11] In this study, adenine but not AuNPs treatment significantly inhibited the increase in cell size induced by IL-18. In a study on the underlying mechanism, we found that IL-18R downstream signals involve p38 MAPK and PI3 kinase. Previous studies have indicated that p38 MAPK induces cardiac hypertrophy and apoptosis.[26] In addition, p38 MAPK elevation is correlated with the onset of cardiac hypertrophy and cell apoptosis in the reperfusion or ischemia-induced heart.[27] The role of p38 MAPK in cardiac gene expression is considered to be significant.[28] In the present study, treatment with IL-18R siRNA and AuNPs did not significantly affect the ratio of phosphor-p38 MAPK to p38 MAPK. These results demonstrated that patients with cardiac hypertrophy will not benefit from AuNPs treatment. The therapeutically effective size and concentration of AuNPs required for the cardioprotective effects should be determined through additional studies.
Some studies have shown that AMPK and MAPK play crucial roles in the progression of experimental autoimmune myocarditis in rats.[29] Studies on myocardial glucose utilization have demonstrated that p38 MAPK may mediate the metabolism of glucose and may be activated by downstream AMPK. AMPK is likely downstream of p38 MAPK in regulating the effects of adenosine on glucose utilization in stressed hearts.[30] Moreover, the AMPK activator, 5-aminoimidazole-4-carboxamide 1-β-D-ribofuranoside (AICAR), enhanced p38 activation in isolated heart muscles.[31] By contrast, ENERGI-F704 (adenine) downregulated the lipopolysaccharide-triggered activation of nuclear factor-kappa B, PI3kinase, and p38 MAPK.[32] Our results showed that the ratio of phosphor-p38 to p38 expression significantly decreased after the cardiomyoblasts were treated with SB203580+adenine+IL-18. Adenine reduced the phosphor-p38 to p38 ratio in the treated cells more than SB203580 alone did. These results suggest adenine reduced IL-18-induced cardiomyoblast hypertrophy related to IL-18R upregulation and signaling of p38 MAPK.
Some studies have reported an association between PI3 kinase and cardiac hypertrophy and IL-18R. PI3 kinase plays a critical role in regulating the size of the heart in mice. The overwhelming expression of constitutionally active PI3 kinase causes an enlarged heart.[33] Inhibitors of PI3 kinase have been proven to block myocardial hypertrophy induced by the ligand.[7] The activation of PI3 kinase/Akt signal pathway is involved in the process of cardiac hypertrophy.[34] Accordingly, PI3 kinase can be a candidate for hypertrophic cardiomyopathy. In our results, cell size and IL-18R expression were reduced by LY294002 treatment. After the treatment, PI3 kinase expression was downregulated significantly. The specific inhibitors and IL-18R siRNA treatment showed inhibition of IL-18R upregulation through IL-18 stimulation and PI3 kinase and p38 MAPK activation. These results indicate that IL-18-induced upregulation of IL-18R through p38 MAPK and PI3 kinase is correlated with the size change of cardiomyoblasts. The results of this study also showed that PI3 kinase expression in cardiomyoblasts was reduced by LY294002+IL-18 and adenine.
In summary, adenine reduced IL-18-induced IL-18R upregulation and increase in cell size, which may involve p38 MAPK and PI3 kinase activation. The antihypertrophic effects may be caused by IL-18R signal inhibition. After AuNPs and adenine treatment, results exhibited that adenine, but not AuNPs, reduced the ratio of phosphor-p38 MAPK to p38 MAPK. In our IL-18-induced cell hypertrophy model, AuNPs did not show a significant relationship with IL-18R, p38 MAPK, and PI3 kinase activation. Other signaling pathways related to IL-18R should be further studied to obtain a deep understanding of the mechanism of AuNPs.
| Conclusions | | |
In this study, we demonstrated that IL-18 and IL-18R are associated with cardiac hypertrophy. We also found that adenine may reduce the size change of IL-18-induced cardiomyoblasts. The beneficial effects of adenine, but not AuNPs, were related to the decrease in IL-18R upregulation by p38 MAPK and PI3 kinase inhibition [Figure 7]. Furthermore, adenine showed higher potency than AuNPs in antihypertrophic effects in this study. IL-18R may be a novel target for developing a potential therapy for cardiac hypertrophy. | Figure 7: Adenine possibly affected interleukin 18 receptor upregulation adenine significantly decreased PI3kinase and p38 MAPK in interleukin 18 receptor upregulation
Click here to view |
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Yingchoncharoen T, Tang WW. Recent advances in hypertrophic cardiomyopathy. F1000Prime Rep 2014;6:12.  |
| 2. | Diwan A, Dorn GW 2 nd. Decompensation of cardiac hypertrophy: Cellular mechanisms and novel therapeutic targets. Physiology (Bethesda) 2007;22:56-64. |
| 3. | Carreño JE, Apablaza F, Ocaranza MP, Jalil JE. Cardiac hypertrophy: Molecular and cellular events. Rev Esp Cardiol 2006;59:473-86. |
| 4. | Thompson SR, McCaskie PA, Beilby JP, Hung J, Jennens M, Chapman C, et al. IL18 haplotypes are associated with serum IL-18 concentrations in a population-based study and a cohort of individuals with premature coronary heart disease. Clin Chem 2007;53:2078-85. |
| 5. | Blankenberg S, Tiret L, Bickel C, Peetz D, Cambien F, Meyer J, et al. Interleukin-18 is a strong predictor of cardiovascular death in stable and unstable angina. Circulation 2002;106:24-30. |
| 6. | Gerdes N, Sukhova GK, Libby P, Reynolds RS, Young JL, Schönbeck U. Expression of interleukin (IL)-18 and functional IL-18 receptor on human vascular endothelial cells, smooth muscle cells, and macrophages: Implications for atherogenesis. J Exp Med 2002;195:245-57. |
| 7. | Chandrasekar B, Mummidi S, Claycomb WC, Mestril R, Nemer M. Interleukin-18 is a pro-hypertrophic cytokine that acts through a phosphatidylinositol 3-kinase-phosphoinositide-dependent kinase-1-Akt-GATA4 signaling pathway in cardiomyocytes. J Biol Chem 2005;280:4553-67. |
| 8. | Colston JT, Boylston WH, Feldman MD, Jenkinson CP, de la Rosa SD, Barton A, et al. Interleukin-18 knockout mice display maladaptive cardiac hypertrophy in response to pressure overload. Biochem Biophys Res Commun 2007;354:552-8. |
| 9. | Wang M, Markel TA, Meldrum DR. Interleukin 18 in the heart. Shock 2008;30:3-10. |
| 10. | Spivak MY, Bubnov RV, Yemets IM, Lazarenko LM, Tymoshok NO, Ulberg ZR. Gold nanoparticles – The theranostic challenge for PPPM: Nanocardiology application. EPMA J 2013;4:18. |
| 11. | Spivak MY, Bubnov RV, Yemets IM, Lazarenko LM, Tymoshok NO, Ulberg ZR. Development and testing of gold nanoparticles for drug delivery and treatment of heart failure: A theranostic potential for PPP cardiology. EPMA J 2013;4:20. |
| 12. | Fu YN, Xiao H, Ma XW, Jiang SY, Xu M, Zhang YY. Metformin attenuates pressure overload-induced cardiac hypertrophy via AMPK activation. Acta Pharmacol Sin 2011;32:879-87. |
| 13. | Beauloye C, Bertrand L, Horman S, Hue L. AMPK activation, a preventive therapeutic target in the transition from cardiac injury to heart failure. Cardiovasc Res 2011;90:224-33. |
| 14. | Young GH, Lin JT, Cheng YF, Huang CF, Chao CY, Nong JY, et al. Identification of adenine modulating AMPK activation in NIH/3T3 cells by proteomic approach. J Proteomics 2015;120:204-14. |
| 15. | Pesant M, Sueur S, Dutartre P, Tallandier M, Grimaldi PA, Rochette L, et al. Peroxisome proliferator-activated receptor delta (PPARdelta) activation protects H9c2 cardiomyoblasts from oxidative stress-induced apoptosis. Cardiovasc Res 2006;69:440-9. |
| 16. | Behera AK, Kumar M, Lockey RF, Mohapatra SS. 2'-5' oligoadenylate synthetase plays a critical role in interferon-gamma inhibition of respiratory syncytial virus infection of human epithelial cells. J Biol Chem 2002;277:25601-8. |
| 17. | Chang JT, Liang YJ, Hsu CY, Chen CY, Chen PJ, Yang YF, et al. Glucagon-like peptide receptor agonists attenuate advanced glycation end products-induced inflammation in rat mesangial cells. BMC Pharmacol Toxicol 2017;18:67. |
| 18. | Kitami T, Logan DJ, Negri J, Hasaka T, Tolliday NJ, Carpenter AE, et al. Achemical screen probing the relationship between mitochondrial content and cell size. PLoS One 2012;7:e33755. |
| 19. | Vassalli G, Milano G, Moccetti T. Role of mitogen-activated protein kinases in myocardial ischemia-reperfusion injury during heart transplantation. J Transplant 2012;2012:928954. |
| 20. | Cargnello M, Roux PP. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev 2011;75:50-83. |
| 21. | Foster FM, Traer CJ, Abraham SM, Fry MJ. The phosphoinositide (PI) 3-kinase family. J Cell Sci 2003;116:3037-40. |
| 22. | Naito Y, Tsujino T, Fujioka Y, Ohyanagi M, Okamura H, Iwasaki T. Increased circulating interleukin-18 in patients with congestive heart failure. Heart 2002;88:296-7. |
| 23. | O'Brien LC, Mezzaroma E, Van Tassell BW, Marchetti C, Carbone S, Abbate A, et al. Interleukin-18 as a therapeutic target in acute myocardial infarction and heart failure. Mol Med 2014;20:221-9. |
| 24. | Woldbaek PR, Sande JB, Strømme TA, Lunde PK, Djurovic S, Lyberg T, et al. Daily administration of interleukin-18 causes myocardial dysfunction in healthy mice. Am J Physiol Heart Circ Physiol 2005;289:H708-14. |
| 25. | Mallat Z, Heymes C, Corbaz A, Logeart D, Alouani S, Cohen-Solal A, et al. Evidence for altered interleukin 18 (IL)-18 pathway in human heart failure. FASEB J 2004;18:1752-4. |
| 26. | Zarubin T, Han J. Activation and signaling of the p38 MAP kinase pathway. Cell Res 2005;15:11-8. |
| 27. | Wang Y, Huang S, Sah VP, Ross J Jr., Brown JH, Han J, et al. Cardiac muscle cell hypertrophy and apoptosis induced by distinct members of the p38 mitogen-activated protein kinase family. J Biol Chem 1998;273:2161-8. |
| 28. | Streicher JM, Ren S, Herschman H, Wang Y. MAPK-activated protein kinase-2 in cardiac hypertrophy and cyclooxygenase-2 regulation in heart. Circ Res 2010;106:1434-43. |
| 29. | Arumugam S, Thandavarayan RA, Veeraveedu PT, Giridharan VV, Soetikno V, Harima M, et al. Involvement of AMPK and MAPK signaling during the progression of experimental autoimmune myocarditis in rats and its blockade using a novel antioxidant. Exp Mol Pathol 2012;93:183-9. |
| 30. | Jaswal JS, Gandhi M, Finegan BA, Dyck JR, Clanachan AS. P38 mitogen-activated protein kinase mediates adenosine-induced alterations in myocardial glucose utilization via 5'-AMP-activated protein kinase. Am J Physiol Heart Circ Physiol 2007;292:H1978-85. |
| 31. | Li J, Miller EJ, Ninomiya-Tsuji J, Russell RR 3 rd, Young LH. AMP-activated protein kinase activates p38 mitogen-activated protein kinase by increasing recruitment of p38 MAPK to TAB1 in the ischemic heart. Circ Res 2005;97:872-9. |
| 32. | Huang BP, Lin CH, Chen HM, Lin JT, Cheng YF, Kao SH. AMPK activation inhibits expression of proinflammatory mediators through downregulation of PI3K/p38 MAPK and NF-κB signaling in murine macrophages. DNA Cell Biol 2015;34:133-41. |
| 33. | Proud CG. Ras, PI3-kinase and mTOR signaling in cardiac hypertrophy. Cardiovasc Res 2004;63:403-13. |
| 34. | Eisenreich A, Rauch U. PI3K inhibitors in cardiovascular disease. Cardiovasc Ther 2011;29:29-36. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
| This article has been cited by | | 1 |
Gold Nanoparticles: Synthesis, Functionalization and Biomedical Applications Especially in Cardiovascular Therapy |
|
| Adli A. Selim, Tamer M. Sakr, Basma M. Essa | | Pharmaceutical Chemistry Journal. 2023; | | [Pubmed] | [DOI] | | | 2 |
Interleukin-18 and cardiovascular diseases: a literature review |
|
| Amina Magomedovna Alieva, Natalia V. Teplova, Vera V. Lyalina, Lidia M. Shnakhova, Rose A. Arakelyan, Elina A. Skripnichenko, Ramiz K. Valiev, Alik M. Rakhaev, Madina Ya. Shavaeva, Igor G. Nikitin | | Medical Journal of the Russian Federation. 2022; 28(3): 201 | | [Pubmed] | [DOI] | |
|
 |
|
|
|
Search Pubmed for